Tag: 200-300

Heffron, Sean P.; Weinstock, Ada; Scolaro, Bianca; Chen, Shiyu; Sansbury, Brian E.; Marecki, Greg; Rolling, Christina C.; El Bannoudi, Hanane; Barrett, Tessa; Canary, James W.; Spite, Matthew; Berger, Jeffrey S.; Fisher, Edward A. published an article in 2021, the title of the article was Platelet-conditioned media induces an anti-inflammatory macrophage phenotype through EP4.Quality Control of Oxybis(ethane-2,1-diyl) bis(2-methylacrylate) And the article contains the following content:

Platelets are increasingly recognized as immune cells. As such, they are commonly seen to induce and perpetuate inflammation; however, anti-inflammatory activities are increasingly attributed to them. Atherosclerosis is a chronic inflammatory condition. Similar to other inflammatory conditions, the resolution of atherosclerosis requires a shift in macrophages to an M2 phenotype, enhancing their efferocytosis and cholesterol efflux capabilities. To assess the effect of platelets on macrophage phenotype. In several in vitro models employing murine (RAW264.7 and bone marrow-derived macrophages) and human (THP-1 and monocyte-derived macrophages) cells, we exposed macrophages to media in which non-agonized human platelets were cultured for 60 min (platelet-conditioned media [PCM]) and assessed the impact on macrophage phenotype and function. Across models, we demonstrated that PCM from healthy humans induced a pro-resolving phenotype in macrophages. This was independent of signal transducer and activator of transcription 6 (STAT6), the prototypical pathway for M2 macrophage polarization. Stimulation of the EP4 receptor on macrophages by prostaglandin E2 present in PCM, is at least partially responsible for altered gene expression and associated function of the macrophages-specifically reduced peroxynitrite production, increased efferocytosis and cholesterol efflux capacity, and increased production of pro-resolving lipid mediators (ie, 15R-LXA4). Platelet-conditioned media induces an anti-inflammatory, pro-resolving phenotype in macrophages. Our findings suggest that therapies targeting hemostatic properties of platelets, while not influencing pro-resolving, immune-related activities, could be beneficial for the treatment of atherothrombotic disease. The experimental process involved the reaction of Oxybis(ethane-2,1-diyl) bis(2-methylacrylate)(cas: 2358-84-1).Quality Control of Oxybis(ethane-2,1-diyl) bis(2-methylacrylate)

The Article related to platelet ep4 antiinflammatory macrophage phenotype atherothrombosis, atherosclerosis, inflammation, macrophages, platelets, prostaglandin e2, Immunochemistry: Phagocytosis and other aspects.Quality Control of Oxybis(ethane-2,1-diyl) bis(2-methylacrylate)

Referemce:
Ester – Wikipedia,
Ester – an overview | ScienceDirect Topics

On July 1, 1997, Baker, Brenda F. published a patent.Application of 53838-27-0 The title of the patent was Compositions and methods for modulating RNA activity through modification of the 5′ cap structure of RNA. And the patent contained the following:

Methods for regulating gene expression in biol. exptl. systems via modification or removal of the 5′ cap structure of targeted RNAs are disclosed. Modification or removal of the 5′ cap structure is achieved in accordance with preferred embodiments utilizing antisense compounds which are complementary to the 5′ terminus of the targeted RNA and have attached to them reactive moieties explicitly designed for chem. modification or cleavage of the 5′ cap structure of RNA. Thus, the 5′ capped RNA target m7GpppGAGCUCCUCUGCUACUCAGA32pCp and the antisense oligodeoxyribonucleotide TCTGAGTAGCAGAGGAGCTCGGT were synthesized; reactive moieties such as Cu(II)-N-(2-mercaptoacetyl)glutamine or Cu(II)-N-(2-mercaptopropionyl)glycine were tethered to the 3′-terminus of the antisense oligonucleotide. The antisense oligonucleotide inhibits complexation of eukaryotic initiation factor 4E protein to the mRNA target by cleaving the 5′-cap. Other tethered mols. were also found to inhibit gene expression at the mRNA level, such as alkyl amines (triethylene tetramine), aromatic amines (imidazole), and lanthanide metal coordination complexes (Eu:DTPA-dien). Compositions that have utility as research reagents and therapeutics for the treatment of diseases are disclosed. The experimental process involved the reaction of (S)-5-tert-Butyl 1-methyl 2-aminopentanedioate(cas: 53838-27-0).Application of 53838-27-0

The Article related to gene expression regulation mrna cap modification, mrna cap modification oligonucleotide probe, Biochemical Genetics: Methods and other aspects.Application of 53838-27-0

Referemce:
Ester – Wikipedia,
Ester – an overview | ScienceDirect Topics

Re, Rebecca N.; Proessdorf, Johanna C.; La Clair, James J.; Subileau, Maeva; Burkart, Michael D. published an article in 2019, the title of the article was Tailoring chemoenzymic oxidation via in situ peracids.Recommanded Product: 2873-29-2 And the article contains the following content:

Epoxidation chem. often suffers from the challenging handling of peracids and thus requires in situ preparation Here, we describe a two-phase enzymic system that allows the effective generation of peracids and directly translate their activity to the epoxidation of olefins. We demonstrate the approach by application to lipid and olefin epoxidation as well as sulfide oxidation These methods offer useful applications to synthetic modifications and scalable green processes. The experimental process involved the reaction of (2R,3S,4R)-2-(Acetoxymethyl)-3,4-dihydro-2H-pyran-3,4-diyl diacetate(cas: 2873-29-2).Recommanded Product: 2873-29-2

The Article related to chemoenzymic oxidation peracid olefin lipid epoxidation, Biochemical Methods: Reagents and other aspects.Recommanded Product: 2873-29-2

Referemce:
Ester – Wikipedia,
Ester – an overview | ScienceDirect Topics

On December 18, 2020, Tomita, Shunpei; Tanaka, Masamichi; Inoue, Michitaka; Inaba, Kazuki; Takahashi, Daisuke; Toshima, Kazunobu published an article.Related Products of 2873-29-2 The title of the article was Diboron-Catalyzed Regio- and 1,2-cis-α-Stereoselective Glycosylation of trans-1,2-Diols. And the article contained the following:

Regio- and 1,2-cis-α-stereoselective glycosylations were investigated using 1,2-anhydroglucose donors and trans-1,2-diol sugar acceptors in the presence of a diboron catalyst. The reactions proceeded smoothly to provide the corresponding 1,2-cis-α-glycosides with consistently very high stereoselectivity and were regioselectivity controlled by the protecting groups of the acceptor. The present glycosylation method was applied successfully to the efficient synthesis of α-1,3-glucan pentasaccharide. The experimental process involved the reaction of (2R,3S,4R)-2-(Acetoxymethyl)-3,4-dihydro-2H-pyran-3,4-diyl diacetate(cas: 2873-29-2).Related Products of 2873-29-2

The Article related to oligosaccharide preparation regioselective stereoselective glycosylation boron catalyzed glycoside pentasaccharide, Carbohydrates: Oligosaccharides and other aspects.Related Products of 2873-29-2

Referemce:
Ester – Wikipedia,
Ester – an overview | ScienceDirect Topics

On January 21, 2022, Kumar, Manoj; Gurawa, Aakanksha; Kumar, Nitin; Kashyap, Sudhir published an article.Application of 2873-29-2 The title of the article was Bismuth-Catalyzed Stereoselective 2-Deoxyglycosylation of Disarmed/Armed Glycal Donors. And the article contained the following:

Bi(OTf)3 promoted direct and highly stereoselective glycosylation of “disarmed” and “armed” glycals to synthesize 2-deoxyglycosides has been reported. The tunable and solvent-controlled chemoselective activation of deactivated glycal donors distinguishing the competitive Ferrier and 1,2-addition pathways was discovered to improve substrate scope. The practical versatility of the method has been amply demonstrated with the oligosaccharide syntheses and 2-deoxyglycosylation of high-value natural products and drugs. The experimental process involved the reaction of (2R,3S,4R)-2-(Acetoxymethyl)-3,4-dihydro-2H-pyran-3,4-diyl diacetate(cas: 2873-29-2).Application of 2873-29-2

The Article related to amino acid glycoside oligosaccharide preparation stereoselective glycosylation catalyst trifluoromethylation, Carbohydrates: Oligosaccharides and other aspects.Application of 2873-29-2

Referemce:
Ester – Wikipedia,
Ester – an overview | ScienceDirect Topics

On January 6, 2020, Nawoj, Miroslaw; Grobelny, Artur; Mlynarski, Jacek published an article.Computed Properties of 2873-29-2 The title of the article was Macrolide Core Synthesis of Calysolin IX Using an Intramolecular Glycosylation Approach. And the article contained the following:

The utility of intramol. glycosylation for the synthesis of the 27-membered macrocyclic ring is highlighted in this first total synthesis of the most complex resin glycoside isolated to date – Calysolin IX. Oligosaccharide-containing macrolides core was effectively constructed by TfOH/NIS-promoted intramol. glycosylation of thioglycosyl donor. As the glycosidic bond must be created en route to target structure, we show that this unusual yet efficient approach can effectively reduce the number of steps in the total synthesis of complex natural macrolides. This attempt is documented as an efficient tool in the synthesis of gigantic macrolide rings thus proving their practical utility in the total synthesis of sugar-containing targets. The experimental process involved the reaction of (2R,3S,4R)-2-(Acetoxymethyl)-3,4-dihydro-2H-pyran-3,4-diyl diacetate(cas: 2873-29-2).Computed Properties of 2873-29-2

The Article related to calysolin synthon preparation oligosaccharide intramol glycosylation macrocyclic resin glycoside, Carbohydrates: Oligosaccharides and other aspects.Computed Properties of 2873-29-2

Referemce:
Ester – Wikipedia,
Ester – an overview | ScienceDirect Topics

On December 17, 2020, Wang, Chen; Liang, Haijing; Hang, Zhaojun; Wang, Zhao-yan; Xie, Qinjian; Xue, Weihua published an article.Product Details of 2873-29-2 The title of the article was Lewis acid/base pair as a catalytic system for α-stereoselective synthesis of 2-deoxyglycosides through the addition of alcohols to glycals. And the article contained the following:

This report describes the α-stereoselective addition of alcs. to glycals promoted by a cooperative Lewis acid/base pair catalytic system composed of B(C6F5)3 and tetrabutylammonium bromide (TBAB), which provides access to 2-deoxylglycosides in high yields. A mechanistic investigation supported by NMR anal. highlights the possible involvement of nucleophilic addition through boron-induced activation of alcs. under the assistance of TBAB. The protocol discussed here features the high stereoselectivity, mild reaction conditions, inexpensive and stable catalysts, and a broad substrate scopes. The experimental process involved the reaction of (2R,3S,4R)-2-(Acetoxymethyl)-3,4-dihydro-2H-pyran-3,4-diyl diacetate(cas: 2873-29-2).Product Details of 2873-29-2

The Article related to disaccharide stereoselective glycosylation deoxyglycoside alc glycal addition catalytic, Carbohydrates: Oligosaccharides and other aspects.Product Details of 2873-29-2

Referemce:
Ester – Wikipedia,
Ester – an overview | ScienceDirect Topics

On March 6, 2020, Palo-Nieto, Carlos; Sau, Abhijit; Jeanneret, Robin; Payard, Pierre-Adrien; Salame, Aude; Martins-Teixeira, Maristela Braga; Carvalho, Ivone; Grimaud, Laurence; Galan, M. Carmen published an article.Electric Literature of 2873-29-2 The title of the article was Copper Reactivity Can Be Tuned to Catalyze the Stereoselective Synthesis of 2-Deoxyglycosides from Glycals. And the article contained the following:

We demonstrate that tuning the reactivity of Cu by the choice of oxidation state and counterion leads to the activation of both “armed” and “disarmed” type glycals toward direct glycosylation leading to the α-stereoselective synthesis of deoxy-glycosides in good to excellent yields. Mechanistic studies show that CuI is essential for effective catalysis and stereocontrol and that the reaction proceeds through dual activation of both the enol ether as well as the OH nucleophile. The experimental process involved the reaction of (2R,3S,4R)-2-(Acetoxymethyl)-3,4-dihydro-2H-pyran-3,4-diyl diacetate(cas: 2873-29-2).Electric Literature of 2873-29-2

The Article related to glycal deoxy glycoside copper catalyst stereoselective glycosylation disaccharide, Carbohydrates: Oligosaccharides and other aspects.Electric Literature of 2873-29-2

Referemce:
Ester – Wikipedia,
Ester – an overview | ScienceDirect Topics

Pal, Kumar Bhaskar; Lee, Jiande; Das, Mrinmoy; Liu, Xue-Wei published an article in 2020, the title of the article was Palladium(II)-catalyzed stereoselective synthesis of C-glycosides from glycals with diaryliodonium salts.SDS of cas: 2873-29-2 And the article contains the following content:

An efficient palladium(II)-mediated C-glycosylation of glycals with diaryliodonium salts is described, providing a new strategy for the synthesis of 2,3-dideoxy C-aryl glycosides with excellent stereoselectivity. The C-glycosylation of a diverse range of glycals, including D-glucal, D-galactal, D-allal, L-rhamnal, L-fucal, L-arabinal, D-maltal, and D-lactal, occurred effectively and the corresponding C-glycosides were obtained in moderate to good yields. This protocol is commended as a significant addition to the field of carbohydrate chem. due to the rich functional group compatibility, broad range of substrate scope and exceptional α-stereoselectivity. The experimental process involved the reaction of (2R,3S,4R)-2-(Acetoxymethyl)-3,4-dihydro-2H-pyran-3,4-diyl diacetate(cas: 2873-29-2).SDS of cas: 2873-29-2

The Article related to glycal stereoselective glycosylation catalyst glycoside preparation disaccharide, Carbohydrates: Oligosaccharides and other aspects.SDS of cas: 2873-29-2

Referemce:
Ester – Wikipedia,
Ester – an overview | ScienceDirect Topics

On March 5, 2021, Takeda, Daiki; Yoritate, Makoto; Yasutomi, Hiroki; Chiba, Suzuka; Moriyama, Takahiro; Yokoo, Atsushi; Usui, Kazuteru; Hirai, Go published an article.Synthetic Route of 2873-29-2 The title of the article was β-Glycosyl Trifluoroborates as Precursors for Direct α-C-Glycosylation: Synthesis of 2-Deoxy-α-C-glycosides. And the article contained the following:

C-Glycosides are metabolically stable mimics of natural O-glycosides and are expected to be useful tools for investigation of the biol. functions of glycans. Here, we describe the synthesis of a series of aryl and vinyl C-glycosides by stereoinvertive sp3-sp2 cross-coupling reactions of 2-deoxyglycosyl boronic acid derivatives with aryl or vinyl halide, mediated by a photoredox/nickel dual catalytic system. Hydrogenation of the vinyl C-glycosides afforded C-linked 2′-deoxydisaccharide analogs. The experimental process involved the reaction of (2R,3S,4R)-2-(Acetoxymethyl)-3,4-dihydro-2H-pyran-3,4-diyl diacetate(cas: 2873-29-2).Synthetic Route of 2873-29-2

The Article related to c deoxyglycoside preparation glycosyl trifluoroborate glycosylation aryl halide, Carbohydrates: Oligosaccharides and other aspects.Synthetic Route of 2873-29-2

Referemce:
Ester – Wikipedia,
Ester – an overview | ScienceDirect Topics