Esters-buliding-blocks

On December 31, 2016, Hsieh, Tsung-Han S.; Fudenberg, Geoffrey; Goloborodko, Anton; Rando, Oliver J. published an article.Application In Synthesis of Bis(2,5-dioxopyrrolidin-1-yl) glutarate The title of the article was Micro-C XL: assaying chromosome conformation from the nucleosome to the entire genome. And the article contained the following:

We present Micro-C XL, an improved method for anal. of chromosome folding at mononucleosome resolution Using long crosslinkers and isolation of insoluble chromatin, Micro-C XL increases signal-to-noise ratio. Micro-C XL maps of budding and fission yeast genomes capture both short-range chromosome fiber features such as chromosomally interacting domains and higher order features such as centromere clustering. Micro-C XL provides a single assay to interrogate chromosome folding at length scales from the nucleosome to the full genome. The experimental process involved the reaction of Bis(2,5-dioxopyrrolidin-1-yl) glutarate(cas: 79642-50-5).Application In Synthesis of Bis(2,5-dioxopyrrolidin-1-yl) glutarate

The Article related to chromosome folding nucleosome dna conformation micro c xl, Biochemical Genetics: Methods and other aspects.Application In Synthesis of Bis(2,5-dioxopyrrolidin-1-yl) glutarate

Referemce:
Ester – Wikipedia,
Ester – an overview | ScienceDirect Topics

On July 1, 1997, Baker, Brenda F. published a patent.Application of 53838-27-0 The title of the patent was Compositions and methods for modulating RNA activity through modification of the 5′ cap structure of RNA. And the patent contained the following:

Methods for regulating gene expression in biol. exptl. systems via modification or removal of the 5′ cap structure of targeted RNAs are disclosed. Modification or removal of the 5′ cap structure is achieved in accordance with preferred embodiments utilizing antisense compounds which are complementary to the 5′ terminus of the targeted RNA and have attached to them reactive moieties explicitly designed for chem. modification or cleavage of the 5′ cap structure of RNA. Thus, the 5′ capped RNA target m7GpppGAGCUCCUCUGCUACUCAGA32pCp and the antisense oligodeoxyribonucleotide TCTGAGTAGCAGAGGAGCTCGGT were synthesized; reactive moieties such as Cu(II)-N-(2-mercaptoacetyl)glutamine or Cu(II)-N-(2-mercaptopropionyl)glycine were tethered to the 3′-terminus of the antisense oligonucleotide. The antisense oligonucleotide inhibits complexation of eukaryotic initiation factor 4E protein to the mRNA target by cleaving the 5′-cap. Other tethered mols. were also found to inhibit gene expression at the mRNA level, such as alkyl amines (triethylene tetramine), aromatic amines (imidazole), and lanthanide metal coordination complexes (Eu:DTPA-dien). Compositions that have utility as research reagents and therapeutics for the treatment of diseases are disclosed. The experimental process involved the reaction of (S)-5-tert-Butyl 1-methyl 2-aminopentanedioate(cas: 53838-27-0).Application of 53838-27-0

The Article related to gene expression regulation mrna cap modification, mrna cap modification oligonucleotide probe, Biochemical Genetics: Methods and other aspects.Application of 53838-27-0

Referemce:
Ester – Wikipedia,
Ester – an overview | ScienceDirect Topics

Heffron, Sean P.; Weinstock, Ada; Scolaro, Bianca; Chen, Shiyu; Sansbury, Brian E.; Marecki, Greg; Rolling, Christina C.; El Bannoudi, Hanane; Barrett, Tessa; Canary, James W.; Spite, Matthew; Berger, Jeffrey S.; Fisher, Edward A. published an article in 2021, the title of the article was Platelet-conditioned media induces an anti-inflammatory macrophage phenotype through EP4.Quality Control of Oxybis(ethane-2,1-diyl) bis(2-methylacrylate) And the article contains the following content:

Platelets are increasingly recognized as immune cells. As such, they are commonly seen to induce and perpetuate inflammation; however, anti-inflammatory activities are increasingly attributed to them. Atherosclerosis is a chronic inflammatory condition. Similar to other inflammatory conditions, the resolution of atherosclerosis requires a shift in macrophages to an M2 phenotype, enhancing their efferocytosis and cholesterol efflux capabilities. To assess the effect of platelets on macrophage phenotype. In several in vitro models employing murine (RAW264.7 and bone marrow-derived macrophages) and human (THP-1 and monocyte-derived macrophages) cells, we exposed macrophages to media in which non-agonized human platelets were cultured for 60 min (platelet-conditioned media [PCM]) and assessed the impact on macrophage phenotype and function. Across models, we demonstrated that PCM from healthy humans induced a pro-resolving phenotype in macrophages. This was independent of signal transducer and activator of transcription 6 (STAT6), the prototypical pathway for M2 macrophage polarization. Stimulation of the EP4 receptor on macrophages by prostaglandin E2 present in PCM, is at least partially responsible for altered gene expression and associated function of the macrophages-specifically reduced peroxynitrite production, increased efferocytosis and cholesterol efflux capacity, and increased production of pro-resolving lipid mediators (ie, 15R-LXA4). Platelet-conditioned media induces an anti-inflammatory, pro-resolving phenotype in macrophages. Our findings suggest that therapies targeting hemostatic properties of platelets, while not influencing pro-resolving, immune-related activities, could be beneficial for the treatment of atherothrombotic disease. The experimental process involved the reaction of Oxybis(ethane-2,1-diyl) bis(2-methylacrylate)(cas: 2358-84-1).Quality Control of Oxybis(ethane-2,1-diyl) bis(2-methylacrylate)

The Article related to platelet ep4 antiinflammatory macrophage phenotype atherothrombosis, atherosclerosis, inflammation, macrophages, platelets, prostaglandin e2, Immunochemistry: Phagocytosis and other aspects.Quality Control of Oxybis(ethane-2,1-diyl) bis(2-methylacrylate)

Referemce:
Ester – Wikipedia,
Ester – an overview | ScienceDirect Topics

On March 18, 2020, Zheng, Xiaoli; Li, Zhuoru; Gao, Wei; Meng, Xiaoting; Li, Xuefei; Luk, Louis Y. P.; Zhao, Yibing; Tsai, Yu-Hsuan; Wu, Chuanliu published an article.COA of Formula: C10H14O3 The title of the article was Condensation of 2-((Alkylthio)(aryl)methylene)malononitrile with 1,2-Aminothiol as a Novel Bioorthogonal Reaction for Site-Specific Protein Modification and Peptide Cyclization. And the article contained the following:

Site-specific modification of peptides and proteins has wide applications in probing and perturbing biol. systems. Herein we report that 1,2-aminothiol can react rapidly, specifically and efficiently with 2-((alkylthio)(aryl)methylene)malononitrile (TAMM) under biocompatible conditions. This reaction undergoes a unique mechanism involving thiol-vinyl sulfide exchange, cyclization, and elimination of dicyanomethanide to form 2-aryl-4,5-dihydrothiazole (ADT) as a stable product. An 1,2-aminothiol functionality can be introduced into a peptide or a protein as an N-terminal cysteine or an unnatural amino acid. The bioorthogonality of this reaction was demonstrated by site-specific labeling of not only synthetic peptides and a purified recombinant protein but also proteins on mammalian cells and phages. Unlike other reagents in bioorthogonal reactions, the chem. and phys. properties of TAMM can be easily tuned. TAMM can also be applied to generate phage-based ADT-cyclic peptide libraries without reducing phage infectivity. Using this approach, we identified ADT-cyclic peptides with high affinity to different protein targets, providing valuable tools for biol. studies and potential therapeutics. Furthermore, the mild reaction conditions of TAMM condensation warrant its use with other bioorthogonal reactions to simultaneously achieve multiple site-specific modifications. The experimental process involved the reaction of (Trimethoxymethyl)benzene(cas: 707-07-3).COA of Formula: C10H14O3

The Article related to sequence alkylthio aryl methylene malononitrile aminothiol bioorthogonal reaction, bioorthogonal reaction protein modification peptide cyclization, Biochemical Methods: Reagents and other aspects.COA of Formula: C10H14O3

Referemce:
Ester – Wikipedia,
Ester – an overview | ScienceDirect Topics

On October 31, 2020, Tewari, Sakshi; Sharma, Shilpi published an article.Product Details of 118-55-8 The title of the article was Rhizobial-metabolite based biocontrol of fusarium wilt in pigeon pea. And the article contained the following:

The application of rhizobial cells for improving pigeon pea fitness has been practiced for ages. As cell-based approaches have limitations, the focus is on the usage of cell-free formulations. In the present study exopolysaccharide (EPS) producing, plant health promoting Bradyrhizobium sp. IC-4059 was monitored for its biocontrol potential against Fusarium udum. Strain IC-4059, its EPS, and supernatant antagonized F.udum by 52.6%, 20.5%, and 48.1%, resp. in comparison to control. Diverse formulations prepared using EPS, supernatant, and cells of strain IC-4059 were: EPS based, supernatant based, IC-4059 liquid culture (rhizobia based), dual combination (IC-4059 cells + supernatant; IC-4059 cells + EPS; EPS + supernatant), and triple combination (IC-4059 cells + supernatant + EPS). The potency of these bioformulations was observed under in planta tubes followed by in vivo pot study, both in F.udum infested and non-infested sets taking pigeon pea cultivar UPAS-120 as a model crop. The study highlighted that seeds receiving triple combination exhibited significantly higher plant growth attributes, nodule enhancing, and disease suppressing activity in comparison to individual application of Bradyrhizobium. Antifungal compounds were analyzed by a metabolomic approach using UPLC-MS. Thus, the study disseminates the tripartite role of triple formulation as a plant growth stimulator, nodule enhancer, and disease suppressor, both under in vitro and in vivo conditions in the presence of phytopathogen F. udum. The experimental process involved the reaction of Phenyl Salicylate(cas: 118-55-8).Product Details of 118-55-8

The Article related to exopolysaccharide bradyrhizobium biocontrol fusarium wilt cajanus, biocontrol, bradyrhizobium, exopolysaccharides, fusarium, nodulation, phytopathogen, Plant Biochemistry: Pathology and other aspects.Product Details of 118-55-8

Referemce:
Ester – Wikipedia,
Ester – an overview | ScienceDirect Topics

On March 31, 2022, Dahbi, Laurence; Farce, Amaury; Kambia, Nicolas; Severin, Isabelle; Dine, Thierry; Moreau, Emmanuel; Sautou, Valerie; Chagnon, Marie-Christine published an article.Reference of Tris(2-ethylhexyl) benzene-1,2,4-tricarboxylate The title of the article was In vitro and in silico approach to study the hormonal activities of the alternative plasticizer tri-(2-ethylhexyl) trimellitate TEHTM and its metabolites. And the article contained the following:

Tri-(2-ethylhexyl) trimellitate (TEHTM) is a plasticizer for polyvinyl chloride (PVC) material used in medical devices. It is an alternative to di-(2-ethylhexyl) phthalate (DEHP), a well-known reprotoxic and endocrine disruptor. As plasticizers are known to easily migrate when in contact with fatty biol. fluids, patient exposure to TEHTM is highly probable. However, there is currently no data on the potential endocrine-disrupting effects of its human metabolites. To evaluate the effects of TEHTM metabolites on endocrine activity, they were first synthesized and their effects on estrogen, androgen and thyroid receptors, as well as steroid synthesis, were investigated by combining in vitro and in silico approaches. Among the primary metabolites, only 4-MEHTM (4-mono-(2-ethylhexyl) trimellitate) showed agonist activities on ERs and TRs, while three diesters were TR antagonists at non-cytotoxic concentrations These results were completed by docking experiments which specified the ER and TR isoforms involved. A mixture of 2/1-MEHTM significantly increased the estradiol level and reduced the testosterone level in H295R cell culture supernatants. The oxidized secondary metabolites of TEHTM had no effect on ER, AR, TR receptors or on steroid hormone synthesis. Among the fourteen metabolites, these data showed that two of them (4-MEHTM and 2/1-MEHTM) induced effect on hormonal activities in vitro. However, by comparing the concentrations of the primary metabolites found in human urine with the active concentrations determined in bioassays, it can be suggested that the metabolites will not be active with regard to estrogen, androgen, thyroid receptors and steroidogenesis-mediated effects. The experimental process involved the reaction of Tris(2-ethylhexyl) benzene-1,2,4-tricarboxylate(cas: 3319-31-1).Reference of Tris(2-ethylhexyl) benzene-1,2,4-tricarboxylate

The Article related to hormonal activity tehtm metabolite steroid hormone, in silico, medical devices, steroidogenesis, t-screen assay, tehtm, her and har reporter gene assays, Toxicology: Toxins and Venoms and other aspects.Reference of Tris(2-ethylhexyl) benzene-1,2,4-tricarboxylate

Referemce:
Ester – Wikipedia,
Ester – an overview | ScienceDirect Topics

On June 30, 2020, Seto, Yoshiki; Ohtake, Hiroto; Sato, Hideyuki; Onoue, Satomi published an article.Application of 85-91-6 The title of the article was Phototoxic risk assessment of dermally-applied chemicals with structural variety based on photoreactivity and skin deposition. And the article contained the following:

This study aimed to verify the feasibility of the screening system for phototoxic risk assessment on dermally-applied chems. with wide structural diversity, as a first attempt. Photochem. properties of test chems., 2-acetonaphthalene, 4′-methylbenzylidene camphor, 6-methylcoumarin, Me N-methylanthranilate, and sulisobenzone, were evaluated in terms of UV absorption and reactive oxygen species (ROS) generation, and PK profiles of the test chems. in rat skin were characterized after dermal co-application. All test chems. showed strong UVA/B absorption with molar extinction coefficients of over 3000 M-1·cm-1, and irradiated 2-acetonaphthalene, 6-methylcoumarin, and Me N-methylanthranilate exhibited significant ROS generation. Dermally-applied 2-acetonaphthalene and 4′-methylbenzylidene camphor indicated high and long-lasting skin deposition compared with the other test chems. Based on the photochem. and PK data, 2-acetonaphthalene was predicted to have potent phototoxic risk. The predicted phototoxic risk of the test chems. by integration of obtained data was mostly consistent with their in vivo phototoxicity observed in rat skin. The screening strategy employing photochem. and PK data would have high prediction capacity and wide applicability for photosafety evaluation of chems. The experimental process involved the reaction of Methyl N-Methylanthranilate(cas: 85-91-6).Application of 85-91-6

The Article related to uv a acetonaphthalene sulisobenzone phototoxicity skin, cassette-dosing pharmacokinetics, photosafety, phototoxicity, reactive oxygen species, structural diversity, Radiation Biochemistry: Other and other aspects.Application of 85-91-6

Referemce:
Ester – Wikipedia,
Ester – an overview | ScienceDirect Topics

On December 31, 2019, Tokhadze, N.; Chennell, P.; Bernard, L.; Lambert, C.; Pereira, B.; Mailhot-Jensen, B.; Sautou, V. published an article.Reference of Tris(2-ethylhexyl) benzene-1,2,4-tricarboxylate The title of the article was Impact of alternative materials to plasticized PVC infusion tubings on drug sorption and plasticizer release. And the article contained the following:

The aim of this study was to assess interactions between drugs and five alternative materials to a reference plasticized PVC i.v. (IV) infusion tubing: three were PVC coextruded with polyethylene (PE), polyurethane (PU) or a thermoplastic elastomer (Styrene-EthyleneButadiene-Styrene (SEBS)) and two were SEBS or thermoplastic olefin (TPO) monolayer tubings. Diazepam and insulin were chosen as resp. reference of absorption and adsorption while paracetamol acted as a neg. control. The concentration of each drug was quantified with liquid chromatog. to evaluate a potential loss after a static contact condition and simulated infusion at 1 mL/h and 10 mL/h dynamic condition by an elec. syringe pump. Plasticizer release was quantified by GC-MS. For all tubings except PVC/PU, no loss of paracetamol was observed in any condition. PVC tubings induced the least loss of insulin amongst all the studied materials. Coextruded PVC/SEBS and PVC/PE presented the lowest zeta potential of all studied materials with resp. values of -39 mV and -36 mV and were related to the highest sorption of insulin while PVC/PU with the highest zeta potential (about -9 mV) presented the highest absorption of diazepam. Coextruded layered materials appeared to have a lower plasticizer release than PVC alone. As a conclusion, PVC/PE and thermoplastic elastomers alone or coextruded with PVC could be interesting alternatives to PVC tubings with regards to sorption phenomena and plasticizer release. The experimental process involved the reaction of Tris(2-ethylhexyl) benzene-1,2,4-tricarboxylate(cas: 3319-31-1).Reference of Tris(2-ethylhexyl) benzene-1,2,4-tricarboxylate

The Article related to pvc infusion tubing drug sorption plasticizer release, Pharmaceuticals: Pharmaceutics and other aspects.Reference of Tris(2-ethylhexyl) benzene-1,2,4-tricarboxylate

Referemce:
Ester – Wikipedia,
Ester – an overview | ScienceDirect Topics

On August 31, 2019, Fan, Cheng-Jie; Huang, Zi-Chun; Li, Bei; Xiao, Wen-Xia; Zheng, En; Yang, Ke-Ke; Wang, Yu-Zhong published an article.Formula: C6H8O3 The title of the article was A robust self-healing polyurethane elastomer: From H-bonds and stacking interactions to well-defined microphase morphology. And the article contained the following:

Supramol. interactions have been extensively considered in the field of self-healing materials due to their excellent reversibility and sensitive responsiveness to environmental stimuli. However, development of a polymeric material with good mech. performance as well as self-healing capacity is very challenging. In this study, we report a robust self-healing polyurethane (PU) elastomer polypropylene glycol-2-amino-5-(2- hydroxyethyl)-6-methylpyrimidin-4-ol (PPG-mUPy) by integrating ureidopyrimidone (UPy) motifs with a PPG segment with a well-defined architecture and microphase morphol. To balance the self-healing capacity and mech. performance, a thermal-triggered switch of H-bonding is introduced. The quadruple H-bonded UPy dimeric moieties in the backbone induce phase separation to form a hard domain as well as enable further aggregation into microcrystals by virtue of the stacking interactions, which are stable in ambient temperature This feature endows the PU with high mech. strength. Meanwhile, a high healing efficiency can be realized, when the reversibility of the H-bond was unlocked from the stacking at higher temperature An optimized sample PPG1000-mUPy50% with a good balance of mech. performance (20.62 MPa of tensile strength) and healing efficiency (93% in tensile strength) was achieved. This strategy will provide a new idea for developing robust self-healing polymers. The experimental process involved the reaction of 3-Acetyldihydrofuran-2(3H)-one(cas: 517-23-7).Formula: C6H8O3

The Article related to self healing polyurethane elastomer microphase morphol, Pharmaceuticals: Pharmaceutics and other aspects.Formula: C6H8O3

Referemce:
Ester – Wikipedia,
Ester – an overview | ScienceDirect Topics

Bian, Shudan; He, Jiajun; Schesing, Kevin B.; Braunschweig, Adam B. published an article in 2012, the title of the article was Polymer pen lithography (PPL)-induced site-specific click chemistry for the formation of functional glycan arrays.Electric Literature of 79642-50-5 And the article contains the following content:

PPL was combined successfully with the CuAAC to form functional mol. arrays over large (> cm2) areas and with feature diameters <1 μm. The problem of the differential transport rates of the reactive components through the aqueous meniscus was solved by embedding them within a PEG matrix. Covalent immobilization as a result of the CuAAC was demonstrated by fluorescence microscopy, and electrochem. anal. confirmed that the surface reactions produce features with high coverage d. Finally, the utility of this approach to glycomics was shown by creating an active array of α-mannose that could be recognized by ConA. In combination with previously reported multiplexing strategies, the authors believe that the approach reported herein could be employed widely to create arrays of biol. probes where the activity has a critical dependence on probe orientation. The experimental process involved the reaction of Bis(2,5-dioxopyrrolidin-1-yl) glutarate(cas: 79642-50-5).Electric Literature of 79642-50-5

The Article related to polymer pen lithog site specific click chem glycan microarray, Biochemical Methods: Apparatus and other aspects.Electric Literature of 79642-50-5

Referemce:
Ester – Wikipedia,
Ester – an overview | ScienceDirect Topics